Review



sinv wt plasmid  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs sinv wt plasmid
    (A) Plasmid constructs were designed to function as vaccine platforms for high level expression of ancestral TBF envelope antigen using an alphavirus infectious clone platform <t>(SINV</t> <t>WT).</t> A gBlock consisting of the TBF +E sequence was inserted into a Sindbis virus infectious clone following a 3’ subgenomic promoter (3’ SGP) via restriction enzyme digestion and Gibson Assembly (SINV +E). (B) Viral titers of passage 1 (p1) from plasmid-transfected BHK-21 cells. BHK cells were infected at MOI=0.01. Supernatant was collected at indicated times and viral titers were determined by standard plaque assay. (C) Cycle threshold (Ct) values of p1 SINV WT (red) and SINV +E (blue) stocks probing for the ancestral TBF E (ASR TBF E).
    Sinv Wt Plasmid, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6775 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sinv+wt+plasmid/XbaI/bio_rxiv__2025__10__31__685878-134-1-11
    Average 99 stars, based on 6775 article reviews
    sinv wt plasmid - by Bioz Stars, 2026-09
    99/100 stars

    Images

    1) Product Images from "Generation of broad-spectrum vaccine platforms against tick-borne flaviviruses using ancestral sequence reconstruction"

    Article Title: Generation of broad-spectrum vaccine platforms against tick-borne flaviviruses using ancestral sequence reconstruction

    Journal: bioRxiv

    doi: 10.1101/2025.10.31.685878

    (A) Plasmid constructs were designed to function as vaccine platforms for high level expression of ancestral TBF envelope antigen using an alphavirus infectious clone platform (SINV WT). A gBlock consisting of the TBF +E sequence was inserted into a Sindbis virus infectious clone following a 3’ subgenomic promoter (3’ SGP) via restriction enzyme digestion and Gibson Assembly (SINV +E). (B) Viral titers of passage 1 (p1) from plasmid-transfected BHK-21 cells. BHK cells were infected at MOI=0.01. Supernatant was collected at indicated times and viral titers were determined by standard plaque assay. (C) Cycle threshold (Ct) values of p1 SINV WT (red) and SINV +E (blue) stocks probing for the ancestral TBF E (ASR TBF E).
    Figure Legend Snippet: (A) Plasmid constructs were designed to function as vaccine platforms for high level expression of ancestral TBF envelope antigen using an alphavirus infectious clone platform (SINV WT). A gBlock consisting of the TBF +E sequence was inserted into a Sindbis virus infectious clone following a 3’ subgenomic promoter (3’ SGP) via restriction enzyme digestion and Gibson Assembly (SINV +E). (B) Viral titers of passage 1 (p1) from plasmid-transfected BHK-21 cells. BHK cells were infected at MOI=0.01. Supernatant was collected at indicated times and viral titers were determined by standard plaque assay. (C) Cycle threshold (Ct) values of p1 SINV WT (red) and SINV +E (blue) stocks probing for the ancestral TBF E (ASR TBF E).

    Techniques Used: Plasmid Preparation, Construct, Expressing, Sequencing, Virus, Transfection, Infection, Plaque Assay

    Overview of animal studies in C57BL/6J mice. Female mice (n=8; 9 weeks old) were vaccinated with 10 5 PFU of SINV +E (blue) subcutaneously (SC) in 50 μL solution at day 0 and day 21. Controls include mice vaccinated with 10 5 PFU SINV WT (mock-vaccinated; red) and PBS (mock challenged; green). Whole blood was harvested and sera isolated by cardiac puncture at day 35 to assess neutralizing antibody titers. At day 35 mice are challenged with a lethal dose of 10 5 PFU of Powassan virus SC diluted in 50 μL solution PBS. Weight, clinical score, and survival were monitored over 21 days post-challenge until end of study. Figure created in https://BioRender.com .
    Figure Legend Snippet: Overview of animal studies in C57BL/6J mice. Female mice (n=8; 9 weeks old) were vaccinated with 10 5 PFU of SINV +E (blue) subcutaneously (SC) in 50 μL solution at day 0 and day 21. Controls include mice vaccinated with 10 5 PFU SINV WT (mock-vaccinated; red) and PBS (mock challenged; green). Whole blood was harvested and sera isolated by cardiac puncture at day 35 to assess neutralizing antibody titers. At day 35 mice are challenged with a lethal dose of 10 5 PFU of Powassan virus SC diluted in 50 μL solution PBS. Weight, clinical score, and survival were monitored over 21 days post-challenge until end of study. Figure created in https://BioRender.com .

    Techniques Used: Isolation, Virus

    Related Articles

    Plasmid Preparation:

    Article Title: Generation of broad-spectrum vaccine platforms against tick-borne flaviviruses using ancestral sequence reconstruction
    Article Snippet: The gBlock was inserted using the NEBuilder ® HiFi DNA Assembly Cloning Kit (New England Biolabs, E5520S) according to manufacturer instructions. .. Briefly, SINV WT plasmid was digested with XbaI restriction enzyme (RE) (New England Biolabs, R0145S) to generate a linear product and gel extracted. .. The gBlock underwent PCR amplification and extension using Q5 ® High-Fidelity DNA Polymerase (New England Biolabs, M0491S) (forward: ACAACACCACCACCTATGTTTTTTGCAGTGACGGCTCT; reverse: CGTCTAGGATCCATGGTTTACGCCCCAACTCCCCT).



    Similar Products

    99
    New England Biolabs sinv wt plasmid
    (A) Plasmid constructs were designed to function as vaccine platforms for high level expression of ancestral TBF envelope antigen using an alphavirus infectious clone platform <t>(SINV</t> <t>WT).</t> A gBlock consisting of the TBF +E sequence was inserted into a Sindbis virus infectious clone following a 3’ subgenomic promoter (3’ SGP) via restriction enzyme digestion and Gibson Assembly (SINV +E). (B) Viral titers of passage 1 (p1) from plasmid-transfected BHK-21 cells. BHK cells were infected at MOI=0.01. Supernatant was collected at indicated times and viral titers were determined by standard plaque assay. (C) Cycle threshold (Ct) values of p1 SINV WT (red) and SINV +E (blue) stocks probing for the ancestral TBF E (ASR TBF E).
    Sinv Wt Plasmid, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/sinv+wt+plasmid/XbaI/bio_rxiv__2025__10__31__685878-134-1-11
    Average 99 stars, based on 1 article reviews
    sinv wt plasmid - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    (A) Plasmid constructs were designed to function as vaccine platforms for high level expression of ancestral TBF envelope antigen using an alphavirus infectious clone platform (SINV WT). A gBlock consisting of the TBF +E sequence was inserted into a Sindbis virus infectious clone following a 3’ subgenomic promoter (3’ SGP) via restriction enzyme digestion and Gibson Assembly (SINV +E). (B) Viral titers of passage 1 (p1) from plasmid-transfected BHK-21 cells. BHK cells were infected at MOI=0.01. Supernatant was collected at indicated times and viral titers were determined by standard plaque assay. (C) Cycle threshold (Ct) values of p1 SINV WT (red) and SINV +E (blue) stocks probing for the ancestral TBF E (ASR TBF E).

    Journal: bioRxiv

    Article Title: Generation of broad-spectrum vaccine platforms against tick-borne flaviviruses using ancestral sequence reconstruction

    doi: 10.1101/2025.10.31.685878

    Figure Lengend Snippet: (A) Plasmid constructs were designed to function as vaccine platforms for high level expression of ancestral TBF envelope antigen using an alphavirus infectious clone platform (SINV WT). A gBlock consisting of the TBF +E sequence was inserted into a Sindbis virus infectious clone following a 3’ subgenomic promoter (3’ SGP) via restriction enzyme digestion and Gibson Assembly (SINV +E). (B) Viral titers of passage 1 (p1) from plasmid-transfected BHK-21 cells. BHK cells were infected at MOI=0.01. Supernatant was collected at indicated times and viral titers were determined by standard plaque assay. (C) Cycle threshold (Ct) values of p1 SINV WT (red) and SINV +E (blue) stocks probing for the ancestral TBF E (ASR TBF E).

    Article Snippet: Briefly, SINV WT plasmid was digested with XbaI restriction enzyme (RE) (New England Biolabs, R0145S) to generate a linear product and gel extracted.

    Techniques: Plasmid Preparation, Construct, Expressing, Sequencing, Virus, Transfection, Infection, Plaque Assay

    Overview of animal studies in C57BL/6J mice. Female mice (n=8; 9 weeks old) were vaccinated with 10 5 PFU of SINV +E (blue) subcutaneously (SC) in 50 μL solution at day 0 and day 21. Controls include mice vaccinated with 10 5 PFU SINV WT (mock-vaccinated; red) and PBS (mock challenged; green). Whole blood was harvested and sera isolated by cardiac puncture at day 35 to assess neutralizing antibody titers. At day 35 mice are challenged with a lethal dose of 10 5 PFU of Powassan virus SC diluted in 50 μL solution PBS. Weight, clinical score, and survival were monitored over 21 days post-challenge until end of study. Figure created in https://BioRender.com .

    Journal: bioRxiv

    Article Title: Generation of broad-spectrum vaccine platforms against tick-borne flaviviruses using ancestral sequence reconstruction

    doi: 10.1101/2025.10.31.685878

    Figure Lengend Snippet: Overview of animal studies in C57BL/6J mice. Female mice (n=8; 9 weeks old) were vaccinated with 10 5 PFU of SINV +E (blue) subcutaneously (SC) in 50 μL solution at day 0 and day 21. Controls include mice vaccinated with 10 5 PFU SINV WT (mock-vaccinated; red) and PBS (mock challenged; green). Whole blood was harvested and sera isolated by cardiac puncture at day 35 to assess neutralizing antibody titers. At day 35 mice are challenged with a lethal dose of 10 5 PFU of Powassan virus SC diluted in 50 μL solution PBS. Weight, clinical score, and survival were monitored over 21 days post-challenge until end of study. Figure created in https://BioRender.com .

    Article Snippet: Briefly, SINV WT plasmid was digested with XbaI restriction enzyme (RE) (New England Biolabs, R0145S) to generate a linear product and gel extracted.

    Techniques: Isolation, Virus